subject
Biology, 06.01.2021 19:50 YARETZYVENCES2144

Which of the following is not a type of substitution mutation. A. a protein is cut off to early. The rest of the protein is not produced because of mutation in the gene coding.
B. The same amino acid is inserted into a protein.
C. A new protein is added, adding to the sequence of amino acids.
D. different amino acids are substituted into protein because the order of amino acids has changed

PLZZ HELP M

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 01:30
Were does condensation occur? a) hydroshereb) lithosherec) boishered) atmosphere
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
Which of the following is not associated with invasive species?
Answers: 1
question
Biology, 22.06.2019 19:30
Consider the activity and specificity of the three enzymes.pepsin is most active in the human and to digest
Answers: 3
You know the right answer?
Which of the following is not a type of substitution mutation. A. a protein is cut off to early. Th...
Questions
question
Mathematics, 02.10.2021 14:00
question
Mathematics, 02.10.2021 14:00
question
Mathematics, 02.10.2021 14:00
Questions on the website: 13722360