subject
Biology, 28.08.2019 06:30 editsa

It is a typical wednesday for thomas. he gets dressed for work in the morning, grabs his briefcase and drives to work. today, thomas decides to come home early to take his dog for a walk. as soon as he unlocks his apartment, he throws his briefcase by the door and changes into jogging shorts. he then grabs his dog and goes for a long walk. he returns, and decides to do some laundry before he gets ready to leave for his basketball game. when thomas is about to leave, he realizes he can’t find his keys. how could thomas use the steps of the scientific method to locate his missing keys?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
If a cell is placed into a hypertonic environment,what will happen to it ? a)it will shrink or shrivel b)nothing c)it will burst d) it will expand or enlarge
Answers: 1
question
Biology, 22.06.2019 19:30
Why do you suppose the structural polysaccharide cellulose does not contain branches?
Answers: 3
question
Biology, 22.06.2019 20:00
Transposon can cause mutations in genes at or near the site of transposon insertion. it is possible for these elements to transpose away from their original site, causing a reversion of the mutant phenotype. in some cases, however, even more severe phenotypes appear when these elements excise from this site, due to events at or near the mutant allele. what might be happening to the transposon or the nearby gene to create more severe mutations?
Answers: 2
You know the right answer?
It is a typical wednesday for thomas. he gets dressed for work in the morning, grabs his briefcase a...
Questions
question
Chemistry, 07.04.2021 06:30
question
Geography, 07.04.2021 06:30
question
Mathematics, 07.04.2021 06:30
question
Chemistry, 07.04.2021 06:30
question
Mathematics, 07.04.2021 06:30
question
Mathematics, 07.04.2021 06:30
Questions on the website: 13722360