AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.

Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.

1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.

In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.

2. In the given set, the possible amino acid sequences can be given as:

Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.

In the given sequence:

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.

To know more about codons, refer to the following link:

link

three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

hello

explanation:

jujj

hey bro i looked it up on google the structure of the eye-spot in euglena viridie, e. ehrenbergii, and phacus pyriyorme is not as franzé haa described it. the so-called “crystal body” and “lens bodies” were not found in any of the individuals of the species examined by me. as earlier observers have stated, the eye-spot consists simply of a mass of pigment granules arranged in a single layer, and probably embedded in a protoplasmic framework, but the latter could not be seen, and its presence was only inferred from the fact that the pigment granules must be held together in some way, thd the eye-spot as a whole is capable of expansion, and that the pigment granules can be separated from each other.

hope this   and an i get brainlsiest