Select all the correct answers. This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The red letters are the noncoding region, and the black letters are the protein-coding region.

ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC

frogs. the lower the ph the higher the acid content. frogs have the highest tolerance in this scenario.

the two answers are a, the population of birds with large beaks will increase on the island, and c, the trait for large beaks will be passed on to future generations through natural selection. the reason for that is because if the birds that have beaks developed for eating small seeds lose all of their food, they will go hungry and eventually starve because they physically cannot eat the large seeds, therefore making the population of large beaked birds higher. also, if the trait of large beaks are dominant on the island over small beaks, then over time the large beaked birds will reproduce more and more, while the smaller beaked birds will reproduce less and less because they can't survive with the food provided. that leads to the trait of small beaks disappearing and the trait of large beaks taking over the island.