PLEASE HELPPP in the image above
what kind of mutation is being shown
a)insertion
b)deletion
c)point mutation

In a lab, scientists grew several generations of offspring of a plant using the method shown. what conclusion can you make about the offspring? a. they formed from meiosis and mitosis. b. they have half the number of chromosomes as their parent. c. they have low genetic variability among them. d. they will be able to reproduce only after they grow flowers.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

What problem would a person most likely have if her kidney did not work correctly?