Biology, 12.01.2021 05:40 mrmendrala
Pls help
What is passed on the the offspring (kids) of the antibiotic resistant bacteria?
bacteria gene
gene for resistance
Answers: 1
Biology, 22.06.2019 08:10
Match the functions to the cell types ? contraction and relaxation. conducting electrochemical signals fighting diseases carrying genetic material
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:30
Why are carbon dioxide concentrations expected to increase? a carbon dioxide concentrations are expected to increase, because fossil fuel burning is expected to increase b. carbon dioxide concentrations are expected to increase, because of an increase in agriculture. c.carbon dioxide concentrations are expected to increase, because more land will have to be cleared for increasing populations and agricultural use. d. all of the above select the best answer from the choices provided mark this and return save and exit next submit submit
Answers: 1
Biology, 22.06.2019 17:20
Can yall plz me on this question im having a hard time think about it
Answers: 1
Pls help
What is passed on the the offspring (kids) of the antibiotic resistant bacteria?
English, 21.05.2021 06:00
Mathematics, 21.05.2021 06:00
Social Studies, 21.05.2021 06:00
Physics, 21.05.2021 06:00
Mathematics, 21.05.2021 06:00
History, 21.05.2021 06:00
History, 21.05.2021 06:00