Biology, 12.01.2021 06:50 Batzs3rdacct
The lake at point A in the diagram is one of the primary points of recharge for the aquifer. Assuming the maximum rate of recharge is occurring in the aquifer, identify the particle type that would most likely make up the majority of the soil.
Answers: 1
Biology, 22.06.2019 04:00
Why are fossils not found in igneous rocks? igneous rocks are made from cooling of lava or magma. igneous rocks are found too deep underground. igneous rocks are too dark in color to contain fossils. igneous rocks are too dense to contain fossils.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
What is the role of dna ligase in the elongation of the lagging strand during dna replication?
Answers: 1
Biology, 22.06.2019 13:20
Choose the incorrect statement (a) the motor end plate membrane is only capable of generating graded potentials, but it is contiguous with the skeletal muscle sarcolemma, which can generate action potentials. (b) propagation of an action potential through the t-tubules into the sarcoplasmic reticulum triggers the release of ca++ into the cytoplasm of a skeletal muscle fiber. (c) the generation of suprathreshold endplate potentials in multiple muscle fibers could be due to the increased frequency of action potential generation at the axon hillock of a single motor neuron. (d) a greater amount of ach would be found in the presynaptic vesicles of a motor unit that fired several action potentials after exposure to botulinum toxin, than in a motor unit that fired several action potentials after exposure to the venom of the krait snake (which contains α-bungarotoxin).
Answers: 2
The lake at point A in the diagram is one of the primary points of recharge for the aquifer. Assumin...
English, 30.08.2020 01:01
Mathematics, 30.08.2020 01:01
English, 30.08.2020 01:01
Mathematics, 30.08.2020 01:01
Computers and Technology, 30.08.2020 01:01
Social Studies, 30.08.2020 01:01
Mathematics, 30.08.2020 01:01
Mathematics, 30.08.2020 01:01
Computers and Technology, 30.08.2020 01:01
Chemistry, 30.08.2020 01:01
English, 30.08.2020 01:01
Business, 30.08.2020 01:01
Mathematics, 30.08.2020 01:01
Mathematics, 30.08.2020 01:01