subject
Biology, 18.01.2021 22:50 hvbrown28

09:42 Which type of scientific statement is defined as a statement of fact that is generally accepted to be true and universal
because it has always been observed to be true?
O theory
O probability
law
hypothesis
Save and Exit
Next
Submit
Mark this and retum
Sign out
US

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 05:30
Hector is back from his morning run and is feeling light-headed because his energy is depleted which food item will provide him with a quick source of carbohydrates
Answers: 1
question
Biology, 22.06.2019 08:00
When a doggo starts to pace around in the same line for a hand full of days. what would that mean?
Answers: 2
question
Biology, 22.06.2019 09:30
Describe your dna model. which part do the straws represent? the pushpins? the paper clips and the black dots you made with the marker?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
09:42 Which type of scientific statement is defined as a statement of fact that is generally accept...
Questions
Questions on the website: 13722367