66.) Match the six kingdoms with the characteristics that describe them.
a) protista
b) somal...
Biology, 20.01.2021 04:50 sardarp1irc5
66.) Match the six kingdoms with the characteristics that describe them.
a) protista
b) somalia
c) planetaria
d) fungi
e) bacteria
f) plantae
g) alumalae
h) archaea
i) animalia
1.) _;multicellular;eukaryotic;zebras, cockroaches
2.)_;multicellular;eukaryotic;ferns , daisies, oak trees
3.)_;unicellular/multicellular;euka ryotic;dinoflagelletes, golden-brown and yellow-green algae, diatoms, amoeba
4.)_;unicellular;prokaryotic;bacter ia, blue-green algae
5.)_;unicellular/multicellular;euka ryotic;molds, yeasts, mushrooms
6.)_;unicellular;prokaryotic;haloph iles, thermophiles
Answers: 3
Biology, 22.06.2019 02:30
What evidence supports the law of conservation of energy? a) mechanical energy is converted to chemical energy during photosynthesis. b) oxygen is made from the breakdown of carbon dioxide during photosynthesis. c)energy is absorbed by chlorophyll and becomes chemical energy during photosynthesis. d)the sun gives off light energy that is absorbed by plants.
Answers: 1
Biology, 22.06.2019 11:30
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Business, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Mathematics, 09.04.2021 22:40
Biology, 09.04.2021 22:40