subject
Biology, 21.01.2021 22:30 Andresssophie7379

Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?

ansver
Answers: 1
Show answers

Another question on Biology

question
Biology, 21.06.2019 20:50
What occupation did muhammad have before the first revelation
Answers: 1
Answer
question
Biology, 21.06.2019 21:30
92 sathe best for the question 11. most animals and plants reproduce sexually. this means that dna is passed down to new organisms from two parental organisms. which of the following is a key advantage of sexual reproduction?
Answers: 3
Answer
question
Biology, 22.06.2019 03:30
Which of the following is an effect of the uneven heating of the earth by the sun? a sea breeze a land breeze a convection current all of the above
Answers: 2
Answer
question
Biology, 22.06.2019 04:00
Indicate the coat color and the proportion of offspring with that color for each of the following crosses of rabbits. assume all are homozygous. albino x albino a) 1/4 chinchilla, 3/4, agouti b) 3/4 albino, 1/4 chinchilla c) all albino
Answers: 3
Answer
You know the right answer?
Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?...
Questions
question
Mathematics, 28.08.2020 20:01
Which property would allow you to use mental computation to simplify the problem 27 + 15 + 3 + 5? additive identity additive inverse commutative prope...
question
Chemistry, 28.08.2020 20:01
Which best describes activation energy? the maximum amount of energy required to end a chemical reaction the amount of energy absorbed in an endotherm...
question
Mathematics, 28.08.2020 20:01
The number of significant digits for 5,000.06 is...
question
Business, 28.08.2020 20:01
Your supervisor has asked to you write a brief email on the vacation policy changes to be distributed to staff. You will need to listen to a voice mai...
question
History, 28.08.2020 20:01
The four factors that affect North Carolina are ??...
question
Business, 28.08.2020 20:01
Andrews and Bates have a written contract in which Bates promises to sell Andrews a piece of real estate. Bates refuses to complete the transaction. A...
question
Physics, 28.08.2020 20:01
Write a testable question you can explore to learn more about the net result of forces pulling in opposite directions....
question
Physics, 28.08.2020 20:01
What values does FCCLA emphasize?...
question
Business, 28.08.2020 20:01
A(n) is a formal listing of the policies, liability limits, fees and user rights and responsibilities associated with using a particular SNS. Select...
question
English, 28.08.2020 20:01
Which idea is expressed in this excerpt from "Anecdote of the Jar" by Wallace Stevens? The wilderness rose up to it, And sprawled around, no longer wi...
question
Mathematics, 28.08.2020 20:01
julio borrowed 120,000 to purchase a home at a compound interest rate of 5% for 25 years. How much did julio pay in all for the home?...
question
Advanced Placement (AP), 28.08.2020 20:01
Consider a mind map and an outline. Which of the following terms describes the format of an outline? hierarchical O graphical O flexible O visual...
question
Physics, 28.08.2020 20:01
A sled is at rest at the top of a slope 2 m high. The sled has a mass of 45 kg. What is the sled's potential energy?...
question
Advanced Placement (AP), 28.08.2020 20:01
Please solve Idk what I'm doing 0-0 ...
question
Mathematics, 28.08.2020 20:01
Find the area of the figure ...
question
Chemistry, 28.08.2020 20:01
3.5 cm in length x 3.2 in height x 0.3cm in with calculate the volume...
question
Mathematics, 28.08.2020 20:01
Given n > 0 , Adam conjectured that 6^n < n^2 + 30 Which value is a counterexample to Adam's conjecture? n = 1 n = 2 n = 3 n = 4...
question
Mathematics, 28.08.2020 20:01
Z(y+y); use y=3, and z=3...
question
Chemistry, 28.08.2020 20:01
Why do you think people have stopped believing in and trusting science?...
question
Mathematics, 28.08.2020 20:01
two angles are supplementary. one angle is 12° less than three times the measure of the other. Find the angles. Show your work :)...
More questions: Biology Another questions
Questions on the website: 13722360
See results (0)