Please help :( ,
Differentiate between the
non-Mendellian inheritance
types...
Biology, 22.01.2021 02:20 barisegebalci165
Please help :( ,
Differentiate between the
non-Mendellian inheritance
types.
Answers: 3
Biology, 21.06.2019 22:00
Where would you expect to see seedless plants, such as ferns and mosses? a. in a botanical museum, because they are all extinct b. low and close to the ground in a moist environment c. climbing high while circling the branches of another plant d. deeply rooted in a forest with a trunk that reaches 20 meters or more
Answers: 1
Biology, 22.06.2019 11:00
Which of these is true of the cytoplasm of an unfertilized egg? a. it is an unevenly distributed mixture of mrna, proteins, organelles, and other substances. b. it does not contain substances that are important in directing development. c. these substances are supplied by the sperm. d. it does not contain substances that are important in directing development. e. development is directed solely by the surrounding cells. f. it is a homogeneous mixture of mrna, proteins, organelles, and other substances. g. it does not contain substances that are important in directing development. h. these substances are produced by the dna of the fertilized zygote.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Computers and Technology, 25.03.2021 21:50
Mathematics, 25.03.2021 21:50
Mathematics, 25.03.2021 21:50
Biology, 25.03.2021 21:50
Health, 25.03.2021 21:50
Mathematics, 25.03.2021 21:50
Social Studies, 25.03.2021 21:50
English, 25.03.2021 21:50