Please help!! i’ll mark brainliest
...
Answers: 1
Biology, 22.06.2019 08:30
If the rna molecule in a human has the nucleotide sequence of guu, this would the amino acid valine would be needed to make the protein. how would this cha process was occurring in a mushroom?
Answers: 2
Biology, 22.06.2019 09:30
Consider the following reaction: 2h2 + o2 —> 2h2o a) what are the reactants in this reaction? b) what are the products in this reaction? c) how many molecules of oxygen are used in this reaction?
Answers: 2
Biology, 22.06.2019 09:40
What molecule contains an organisms genetic material, passed down from parents to their offspring
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Social Studies, 12.12.2020 16:40
Mathematics, 12.12.2020 16:40
Social Studies, 12.12.2020 16:40
Mathematics, 12.12.2020 16:40
Mathematics, 12.12.2020 16:40
Mathematics, 12.12.2020 16:40
Computers and Technology, 12.12.2020 16:40
Mathematics, 12.12.2020 16:40
English, 12.12.2020 16:40
Business, 12.12.2020 16:40
English, 12.12.2020 16:40