2) blue, black, purple
![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 18:40
Natalie had random hand movements when she was two months old. when she was six months old, she used to grab a block with her whole hand. now at the age of ten months, she can grasp the same block with her thumb and forefinger. this sequence of growth in her hand and finger movements is according to the pattern.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:30
The table below shows data for a population of fish in a pond. fish body color # of fins scales? tail shape a silver 4 yes fan b pink 4 yes flat c black 4 yes fan d orange 4 yes flat e orange 4 yes fan f silver 4 yes flat which of the above characteristics would be most in developing a classification system for the fish? a. body color and tail shape b. presence of scales and tail shape c. body color and number of fins d. number of fins and presence of scales
Answers: 2
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
PICK ONE ONLY FOR EACH ONE
1) harry potter, maze runner, divergent
2) blue, black, purple
2) blue, black, purple
Questions
![question](/tpl/images/cats/istoriya.png)
History, 16.09.2019 20:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2019 20:50
![question](/tpl/images/cats/istoriya.png)
History, 16.09.2019 20:50
![question](/tpl/images/cats/istoriya.png)
History, 16.09.2019 20:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 16.09.2019 20:50
![question](/tpl/images/cats/biologiya.png)
Biology, 16.09.2019 20:50
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2019 20:50
![question](/tpl/images/cats/himiya.png)
Chemistry, 16.09.2019 20:50
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2019 20:50
![question](/tpl/images/cats/biologiya.png)
Biology, 16.09.2019 20:50
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2019 20:50
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
English, 16.09.2019 20:50
![question](/tpl/images/cats/health.png)
Health, 16.09.2019 20:50