Biology, 22.02.2021 02:10 jayonelijah
Case #28104
Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.
Part Two
Copy the DNA sequences for each suspect into a Word document.
Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)
Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).
Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.
Repeat step 1 with the DNA samples for Suspects B and C.
Suspect A
TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA
Suspect B
TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA
Suspect C
TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA
Probe
AGGT
Questions
Answer these following questions in the essay box below.
Which suspect most likely committed the robbery?
How do you know?
Answers: 3
Biology, 22.06.2019 00:00
As a small change in a person's dna can cause a genetic disorder
Answers: 3
Biology, 22.06.2019 11:30
Nucleic acids offer variability because they contain alternate forms of genes called .
Answers: 1
Biology, 22.06.2019 13:00
What problem would a person most likely have if her kidney did not work correctly?
Answers: 2
Case #28104
Last month, Hudson National Bank was robbed by an unidentified man. The robber wore glo...
Mathematics, 06.11.2020 17:30
Mathematics, 06.11.2020 17:30
Social Studies, 06.11.2020 17:30
Social Studies, 06.11.2020 17:30
Mathematics, 06.11.2020 17:30
Social Studies, 06.11.2020 17:30
Mathematics, 06.11.2020 17:30
Mathematics, 06.11.2020 17:30
Engineering, 06.11.2020 17:30
Arts, 06.11.2020 17:30
Engineering, 06.11.2020 17:30
Mathematics, 06.11.2020 17:30
English, 06.11.2020 17:30
Mathematics, 06.11.2020 17:30
History, 06.11.2020 17:30