AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

How do chloroplasts set plants apart from other living things

How does this experiment explain why it is often milder in areas such as coastal maryland while areas such as kansas or iowa have more extremes in temperature

Juan and carol were studying invertebrates in biology. they knew that segmented or earth worms preferred a dark, moist habitat. during this lab, they would be investigating the responses of organisms called planaria or dugesia tigrina. these were simple flatworms that still had a one-way digestive system and a very simple nervous system. juan and carol placed the planaria in a petri dish containing cool, distilled water that was partially covered with black paper. they shined a light on the dish. next, they removed the paper and placed a small amount of chicken liver at one end of the dish. they added a few large salt crystals to the water. finally, they added drops of hot water to the cool water in the petri dish. their results can be seen in the data table. according to their experiment, all but one conclusion is valid.