What is the effect of the host genome when the page is lysogenic?
Pleas helppp...
Biology, 24.02.2021 18:20 hello123485
What is the effect of the host genome when the page is lysogenic?
Pleas helppp
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
Which of the following types of reactions would decrease the entropy within a cell? a. dehydration reaction, b. hydrolysis, c. respiration, d. digestion, e. catabolism.
Answers: 2
Mathematics, 04.07.2019 14:30
Mathematics, 04.07.2019 14:30
Social Studies, 04.07.2019 14:30
Mathematics, 04.07.2019 14:30
Mathematics, 04.07.2019 14:30
History, 04.07.2019 14:30