A molecule of DNA is shown here. When comparing two family members with different appearances, it is assumed that their phenotypes are connected to differences in their DNA. Which components of the DNA are responsible for the phenotype differences
between the related individuals? Select ALL that apply.
A
The sequence of the bases on the DNA molecule is different for the two
individuals.
B)
The arrangement of the molecule into a helix is variable between the two
individuals.
The base pairing rule for the nitrogenous bases is different for the two
individuals.
D)
The type of sugar that makes up the DNA molecule is different for the two
individuals.
E)
The expression of certain genes on the DNA over others is different for the
two individuals

What happens during interphase? (1)the nucleus grows to its full size. (2)the cell grows to its full size. (3)the nucleus divides into two nuclei. (4)the cell divides into two cells.

In a cross between individuals of a species of tropical fish, all of the male offspring have long tail fins, and none of the females possess the trait. mating two of the f1 fish fails to produce females with the trait. explain the inheritance pattern of the trait.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?