Please help me The DNA base sequence for a short gene is
TATGATACCTTGATAGCTATGTGATTG
What is the amino acid sequence of the polypeptide produced according to this DNA information? Use the genetic code chart below and your knowledge of
transcription and translation to figure out the message?

Which technically is nasa developing that will astronauts reach mars

Which of the following best describes the relationship between glucose and complex molecules such as hormones?

(select all the correct choose each statement that is scientific. - the opinions of randomly selected participants in a survey prove the idea that global temperatures are not increasing on earth. - the universe's average temperature and rate of expansion support the idea that it began as one super-dense and hot mass 13.8 billion years ago. - ocean tides are caused by the uneven gravitational pulls of the moon and sun on different parts of earth. - human life is more valuable than other forms of life on earth because humans are more intelligent than other organisms.