Have you heard or learned about Estuaries?
Intertidal zone?
Estuaries are bodies of water and...
Have you heard or learned about Estuaries?
Intertidal zone?
Estuaries are bodies of water and their surrounding coastal habitats
typically found where rivers meet the sea. Intertidal zone-is the shallowest
part of the ocean ecosystem, where the ocean is covered and uncovered as
the tide in and out.
Directions: Draw an estuary inside the box and describe them in the space
provided on the right.
Answers: 1
Biology, 22.06.2019 00:30
On a recent expedition to a remote region of northern canada, scientists uncovered skeletal remains from about 100,000 years ago. surprisingly, all the skeletal remains, which included many species from differing biological families and spanned about two thousand years, showed evidence of experiencing temperatures in excess of 1000 degrees fahrenheit (or 538 degrees celsius). which of the following, if true, best explains the apparent paradox between the cold environment and the evidence of the bones experiencing hot temperatures? (a) chemical changes that naturally occur during the process of decay in only one north canadian species produce the same evidence of the species' skeletons being exposed to hot temperatures as the expedition scientists found. (b) a little over 103,000 years ago, a large fire is known to have occurred in northern canada. (c) strong evidence exists that as early as 70,000 years ago, homo sapiens around the world relied heavily on fire to cook animals. (d) in the same expedition and in roughly the same layer of excavation, scientists found rudimentary wood cutting and hunting tools used by early humans.
Answers: 3
Biology, 22.06.2019 04:30
Taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? view available hint(s)taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? the enzyme will not work on human dna.nothing should be altered.the ph should be decreased.the temperature should be raised.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 11.01.2020 08:31
Mathematics, 11.01.2020 08:31
English, 11.01.2020 08:31
English, 11.01.2020 08:31
Mathematics, 11.01.2020 08:31
Social Studies, 11.01.2020 08:31
Mathematics, 11.01.2020 08:31