Select all the parts of the nervous system:
Neuron
Pancreas
Tibia
Vein
Scia...
Answers: 1
Biology, 21.06.2019 13:30
Plzz hurry im being timed during times of vigorous physical activity, muscles require a constant supply of oxygen. how does the body respond to these needs? a. breathing rate and heart rate both decrease. b. breathing rate and heart rate both increase. c. heart rate decreases, but breathing rate remains stable. d. breathing rate increases, but heart rate remains stable.
Answers: 1
Biology, 21.06.2019 20:00
Two male mice, which we will call male a and male b, are both phenotypically normal. male a was from a litter that contained half phenotypically normal mice and half dwarf mice. the mother of male a was known to be homozygous for the normal igf2 allele. male b was from a litter of eight mice that were all phenotypically normal. the parents of male b were a phenotypically normal male and a dwarf female. male a and male b were put into a cage with two female mice that we will call female a and female b. female a is a dwarf and female b is phenotypically normal. the parents of these two females were unknown, although it was known that they were from the same litter. the mice were allowed to mate with each other, and the following data were obtained: female a gave birth to three dwarf babies and four normal babies. female b gave birth to four normal babies and two dwarf babies. which male(s)mated with female a and female b? male a with both females male a with female b, and male b with female a male a with female a, and male b with female b could not be determined male b with both females
Answers: 3
Biology, 22.06.2019 10:30
What is the main reason that attitudes are more often revealed in spoken rather than written language? a. in writing, we try to put the "best face" on what we write. b. we speak far more often than we write. c. in writing, we can more easily conceal our attitudes. d. in spoken language, we are often careless in our use of words.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 06.09.2020 14:01
Mathematics, 06.09.2020 14:01
History, 06.09.2020 14:01
Biology, 06.09.2020 14:01
Social Studies, 06.09.2020 14:01
Mathematics, 06.09.2020 14:01
Advanced Placement (AP), 06.09.2020 14:01
History, 06.09.2020 14:01
History, 06.09.2020 14:01
Mathematics, 06.09.2020 14:01
History, 06.09.2020 14:01
Mathematics, 06.09.2020 14:01
History, 06.09.2020 14:01