1.What is a codon? What does it tell the ribosome?
2.What are amino acids?
3.How does a ribos...
Biology, 11.03.2021 22:30 SethSimunek
1.What is a codon? What does it tell the ribosome?
2.What are amino acids?
3.How does a ribosome know when a protein strand should start producing and when it should stop adding amino acids?
4.Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Answers: 2
Biology, 21.06.2019 14:50
Previous pagenext pagepage 3 ofquestion 3 (1 point)which of the following consist of cells that do not have a nucleus? of the above
Answers: 2
Biology, 21.06.2019 23:00
The tasmanian devil, a marsupial carnivore, is facing extinction due to devil facial tumor disease (dftd) which causes bulging cancerous lumps and lesions to erupt around the face and neck — often causing enough deformation to make seeing or eating difficult. dftd has evolved into a contagious cancer, a trait that is unique among cancers. devil mating behavior involves biting around the head and neck, allowing cells from one individual — especially cells from the crumbly dftd tumors — to be transferred to the wounds or face of a new individual. this marsupial was once found across australia, but sea levels rose, isolating the tasmanian population, while the australian population went extinct. what would be an outcome of genetic isolation that is likely to have impacted the spread of dftd? a) reduced territory puts diseased individuals in greater contact with non-diseased ones. b) inbreeding results in less variation in facial features so the cancer is generally fatal. c) genetic isolation has made it difficult for scientists to develop a vaccine against dftd. d) the lack of genetic variation in the immune system of tasmanian devils minimizes resistance to the disease.
Answers: 3
Biology, 22.06.2019 06:50
The fascicles of the deltoid are ; the fascicles of the pectoralis parallel; bipennate fusiform; unipennate multipennate; triangular bipennate; fusiform
Answers: 3
Biology, 22.06.2019 07:30
1. seamount a raised footwall block between normal fault creates this 2. syncline break between rocks where a hanging wall rises relative to a footwall 3. hot spring on rolling hills, this a dip between hills 4. volcanic neck created when a block with hanging walls slips down between normal faults 5. caldera underwater volcano that never reaches above sea level 6. horst natural hot water on earth's surface containing many minerals 7. graben underwater volcano whose top is eroded flat by waves 8. crater less than a mile in diameter; looks like a bowl at the top of a volcano 9. guyot magma that filled the central vent that remains after the volcano has eroded 10. reverse fault over 1 mile in diameter; looks like a bowl over a volcano
Answers: 3
Mathematics, 15.01.2021 22:40
Mathematics, 15.01.2021 22:40
English, 15.01.2021 22:40
Mathematics, 15.01.2021 22:40
Mathematics, 15.01.2021 22:40
Chemistry, 15.01.2021 22:40
Mathematics, 15.01.2021 22:40
Spanish, 15.01.2021 22:40
Health, 15.01.2021 22:40
Mathematics, 15.01.2021 22:40
Computers and Technology, 15.01.2021 22:40
Mathematics, 15.01.2021 22:40