subject
Biology, 19.03.2021 19:00 ghazanfarwaheed7967

¡Ahora si! , te presento un RETO MAYOR: Redacta un texto en el que respondas las siguientes preguntas sobre el fenómeno de las migraciones: ¿Por qué razones las personas, familias o grupos sociales han migrado recientemente y en el pasado? ¿Consideras que las migraciones tienen consecuencias positivas en la vida de los migrantes y en los lugares a los que llegan? ¿Por qué?.
Te sugiero considerar los siguientes elementos:

o Título
o Introducción (en la que se presenta la problemática)
o Desarrollo (señalando las fuentes utilizadas)
o Conclusión

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 19:00
Consider the diagram below, which represents components of the biosphere. what do the two arrows in the diagram most likely represent? a. radiation b. photosynthesis c. cellular respiration d. energy conversions will give to anyone who answers quickly
Answers: 1
question
Biology, 21.06.2019 20:00
Common commercial benefits of microorganisms include synthesis ofa. insulin.b. antibiotics.c. aspirin.d. antibiotics and aspirin.e. antibiotics and insulin.
Answers: 1
question
Biology, 22.06.2019 05:30
Where can dna be found in a prokaryotic cell
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
¡Ahora si! , te presento un RETO MAYOR: Redacta un texto en el que respondas las siguientes pregunt...
Questions
question
History, 12.01.2021 23:20
question
Social Studies, 12.01.2021 23:20
question
Mathematics, 12.01.2021 23:20
question
Mathematics, 12.01.2021 23:20
question
Mathematics, 12.01.2021 23:20
question
Mathematics, 12.01.2021 23:20
Questions on the website: 13722360