subject
Biology, 23.03.2021 16:20 jamesmith20

This is a source of energy that can be concentrated on a dish, trough, or tower to create electricity-This energy source takes eight minutes to reach the Earth-The energy source is converted directly into electricity using PV cells *

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 01:30
What occurs to the cell during mitosis
Answers: 2
question
Biology, 22.06.2019 04:10
Select the correct answer. tay-sachs disease is caused by a mutation in the hexa gene located on chromosome 15. tay-sachs follows an autosomal recessive pattern of inheritance. with the of the diagram, identify which of the offspring will be an unaffected carrier. a diagram showing the genes of parents who are carriers of tay-sachs disease a. a, b, and c b. b and c c. a and d d. a e. d
Answers: 3
question
Biology, 22.06.2019 09:50
Tropical rain forests support more species per unit area than any other terrestrial ecosystem. what is one way rain forests are important to the health of the biosphere?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
This is a source of energy that can be concentrated on a dish, trough, or tower to create electricit...
Questions
question
Mathematics, 09.03.2020 05:34
question
History, 09.03.2020 05:36
Questions on the website: 13722363