subject
Biology, 24.03.2021 14:00 dmead22284

If we could represent what is going on inside a plant using a simulation: What inputs and outputs of the plant system would we want to represent?

What structures of the plant would we want to represent?

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 19:30
Indica el nombre y la fucion de los vasos sanguineos que entran y salen de los riñones
Answers: 1
question
Biology, 21.06.2019 22:00
Im is in a crowd of people at the mall looking for his girlfriend tammy, who was supposed to meet him for dinner. jim realizes tammy is across the room as he catches a whiff of her overpowering perfume, 'paris #6'. which process explains why jim is able to smell the perfume?
Answers: 2
question
Biology, 22.06.2019 09:10
Explain the cellular functions that occur when antibiotics attack a bacteria cell. a. antibiotics target the cell wall, cell membrane, and the processes of protein and nucleic acids production in bacteria to rupture the cell. b. antibiotics create dormant resistant endospores to preserve the genetic material and rupture the cell. c. antibiotics target the cell wall and form a bridge-like connection to form conjugation. d. antibiotics use binary fission to grow twice its size, replications its dna, and split into two cells.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
If we could represent what is going on inside a plant using a simulation: What inputs and outputs o...
Questions
question
Mathematics, 20.05.2021 19:10
question
Mathematics, 20.05.2021 19:10
question
Mathematics, 20.05.2021 19:10
question
SAT, 20.05.2021 19:10
Questions on the website: 13722362