Biology, 24.03.2021 20:50 hernsl0263
Santos and Lüderitz are the same distance from the equator, and both cities are near the ocean. The air temperature in Lüderitz is colder than the air temperature in Santos. What causes the air temperature in these places to be different? Explain what causes the difference as completely as you can.
Answers: 3
Biology, 21.06.2019 13:30
Which allele combination represein a dihybrid cross for round and yellow seeds (rryy x rryy), what is the probability of having green and wrinkled seeds? nts a male who has an x-linked recessive disorder? which allele combination represents a male who has an x-linked recessive disorder?
Answers: 1
Biology, 22.06.2019 09:00
Apuppy’s tendency to chew is inherited through which of the following? a. through learned behavior b.through genes c. through seasonal cycles d. through hibernation
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Santos and Lüderitz are the same distance from the equator, and both cities are near the ocean. The...
Mathematics, 04.11.2021 14:00
Mathematics, 04.11.2021 14:00
Mathematics, 04.11.2021 14:00
Medicine, 04.11.2021 14:00
Computers and Technology, 04.11.2021 14:00
Mathematics, 04.11.2021 14:00
English, 04.11.2021 14:00
English, 04.11.2021 14:00
Mathematics, 04.11.2021 14:00
Mathematics, 04.11.2021 14:00
Mathematics, 04.11.2021 14:00
Chemistry, 04.11.2021 14:00