![subject](/tpl/images/cats/biologiya.png)
7. A protein is a long strand of assembled in the .
a. amino acids—nucleus
b. amino acids—ribosomes
c. RNA—nucleus
d. RNA—ribosomes
8. Each amino acid is coded for by .
a. a single DNA base
b. a sequence of three RNA molecules
c. a sequence of three DNA bases
d. a sequence of three proteins
9.What is NOT true about RNA?
a. It stands for ribonucleic acid.
b. It helps DNA make proteins.
c. It has all of the same bases as DNA.
d. There are two types: messenger RNA and transfer RNA.
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:00
True or false: (a) the strings of little red dots represent carbohydrates. (b) the model is called a bilayer because there are two main types of molecules present, lipids and proteins. (c) the many black lines represent amino acid tails. (d) this model shows membrane transport. (e) the blue ovals are hydrophobic. (f) the blue ovals represent phospholipid heads.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:30
Por qué crees que los huevos con cáscara se llaman amnióticos?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 18:00
How do specific cell structures and organelles contribute to maintaining homeostasis in the cell?
Answers: 1
You know the right answer?
7. A protein is a long strand of assembled in the .
a. amino acids—nucleus
b. amino acids—ri...
b. amino acids—ri...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 04.01.2020 17:31
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 04.01.2020 17:31
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.01.2020 17:31
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 04.01.2020 17:31
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 04.01.2020 17:31
![question](/tpl/images/cats/mat.png)
Mathematics, 04.01.2020 17:31
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
History, 04.01.2020 17:31
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.01.2020 17:31
![question](/tpl/images/cats/istoriya.png)
History, 04.01.2020 17:31