PLEASE HELP QUICK (i give brainliest) thanks

Write a paragraph at least 5 sentences “why all vaccinations should be mandatory”

Mouse liver cells were homogenized and the homogenate subjected to equilibrium density-gradient centrifugation with sucrose gradients. fractions obtained from these gradients were assayed for marker molecules (i.e., molecules that are limited to specific organelles). the results of these assays are shown in the figure. the marker molecules have the following functions: cytochrome oxidase is an enzyme involved in the process by which atp is formed in the complete aerobic degradation of glucose or fatty acids; ribosomal rna forms part of the protein-synthesizing ribosomes; catalase catalyzes decomposition of hydrogen peroxide; acid phosphatase hydrolysis monophosphoric esters at acid ph; cytidylyltransferase is involved in phospholipid biosynthesis; and amino acid permease aids in transport of amino acids across membranes. a) name the marker molecule and give the number of the fraction that is most enriched for each of the following cell components: lysosomes; peroxisomes; mitochondria; plasma membrane; rough endoplasmic reticulum; smooth endoplasmic reticulum.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?