subject

Biology, 01.04.2021 17:30 sumitshekhar348

What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?

ansver

Answers: 3

Show answers

Another question on Biology

question

Biology, 21.06.2019 23:30

In iceland, the mid atlantic ridge runs through the center of the contry. what can you conclude about the apperence of iceland many thousands of years from now?

Answers: 1

question

Biology, 22.06.2019 05:30

How does the nervous system affect the excretory system?

Answers: 1

question

Biology, 22.06.2019 09:00

When the cell concentrates potassium within, against the natural tendency of matter, it is performing a.passive diffusion b.facilitated diffusion c.active transport d.pinocytosis

Answers: 2

question

Biology, 22.06.2019 09:00

What should be the strand of complementary dna produced by the strand of dna shown below cgt ata

Answers: 1

You know the right answer?

What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...

Questions

question

Geography, 01.10.2019 20:00

Which part of the rock cycle can only occur because of thermal convection...

question

Physics, 01.10.2019 20:00

Which type(s) of electromagnetic radiation do human bodies emit? which type(s) can our senses detect?...

question

Biology, 01.10.2019 20:00

Describe one piece of evidence that a chemical reaction occurs when baking soda is added to vinegar...

question

Biology, 01.10.2019 20:00

Which pairing matches the type of substance with the item it donates? acid: electron pair; base: h+ ion acid: proton; ba...

question

Chemistry, 01.10.2019 20:00

What is science and what is the importance of this subject?...

question

English, 01.10.2019 20:00

Which quotation best describes the narrator’s perspective of her new life after the culture shock of moving from caribbean nation of antiqua to new yo...

question

Health, 01.10.2019 20:00

How many oranges does the average american eat in one year?...

question

History, 01.10.2019 20:00

Which principle of american democracy is included in the magna carta? limited government the right to bear arms freedom of the press the right to vot...

question

History, 01.10.2019 20:00

During the mississippian period, many native american groups set up large fields where they primarily grew a) rice. b) maize. c) cotton. d) soybeans....

question

Biology, 01.10.2019 20:00

Which sentence correctly uses a comma to separate the introductory phrase? the children's literature center, displays the world's smallest book. the...

question

Mathematics, 01.10.2019 20:00

Me solve this problem in its simplest form 7 1/4 -4 5/6=...

question

Mathematics, 01.10.2019 20:00

Which statement can be used to prove that a given parallelogram is a rectangle? the diagonals of the parallelogram are congruent. t...

question

Biology, 01.10.2019 20:00

Constitution is the supreme law of a country...

question

History, 01.10.2019 20:00

Which of the following is the only part of government that can declare war a) the president b) the military c) congress d) the...

question

English, 01.10.2019 20:00

what is the climax of a story? a. the point in a story where readers learn exactly how the conflict was resolved b. the beginning...

question

Physics, 01.10.2019 20:00

which of the following is the a balanced equation for this reaction? a. c7h16 + o2? co2 + h2o b. c7h16 + o2? co2 + 8h2o c. c7h16 +...

question

Business, 01.10.2019 20:00

Ahealth clinic is debating about whether to spend money on a dialysis machine to treat those in the neighborhood suffering with diabetes. diabet...

question

Mathematics, 01.10.2019 20:00

Simplify the expression (−1 − 3i)(−6 − i)...

question

Health, 01.10.2019 20:00

What is the wavelike involuntary movement of muscle that cause the food to move in a forward direction through the digestive tract?...

question

English, 01.10.2019 20:00

‘why sit here and die’ speech by maria w. stewart 1832, how do we define the roles of men and women?...

More questions: Biology Another questions

Questions on the website: 13722367