subject
Biology, 02.04.2021 22:00 milo3685

The is when a few individuals in a population colonize a new location that is
separate from the old population.
a. Founder effect
b. Bottleneck effect
C. Asexual reproduction
d. Sexual reproduction

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 05:00
How will you manage your time to accomplish the necessary tasks both on the job and at home?
Answers: 1
question
Biology, 22.06.2019 06:00
During the process of two rails or sides break apart and attract new nucleotide bases to form a new and complete strand.
Answers: 2
question
Biology, 22.06.2019 06:20
Which of these statements is false? a. others may notice a problem with a relationship before the people involved. b. the first sign of a problem with a relationship is a feeling of anger. c. damaged relationships can be repaired. d. even good relationships can be damaged.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The is when a few individuals in a population colonize a new location that is
separate from t...
Questions
question
Social Studies, 11.01.2021 22:30
question
Geography, 11.01.2021 22:30
Questions on the website: 13722361