Completa las siguientes hebras de ADN 5' ATCGTACGTAGCTACGTAGCT 3'
5' GGTATTACGGGCTTAGGCGCCCAA 3'
5' AATTCGGGATTCCATTGCTGAC 3'

yes.

Explanation:

hdjsbsjwhsjbsjwbsjsjs

you are certainly talking about this picture:

a: is the label of the white square, it is showing the  replication fork, formed by helicase (d) ==> so it is the site of dna separation and replication 

b: is a new dna brand that is following directly the replication fork, so it is continuous ==> built continuously from 5' to 3

c: dna polymerase cannot replicate dna on its own, it needs the of their proteins, and one of them plays the role of a clamp which fixes  the dna with the dna template and increases  the processivity of the enzyme. ==>   stops polymerase from falling off the  template.

d: is the enzyme responsible for forming the replication fork (helicase) ==> unwinds and separates dna into two strands

e: is the delayed strand, it is built  in the opposite sense of the helicase, so dna will be built in fragments ==> built  fragments from 5' to 3 joins

and finally f: is the enzyme that builds  the new dna strand (dna polymerase) ==>   adds nucleotides to make a new dna helix.

credit: gradman555p98x9p

read more on -

there are mainly three domains in biological classification namely; archaea, bacteria, and eukarya.

archaea includes all the prokaryotic cells which are characterized by their lipid membranes. they have branched hydrocarbon which is attached to glycerol through an ether linkage.

bacteria includes all the prokaryotic cells, the cell membrane of which are made up of the unbranched fatty acid chain. in addition, they are attached to glycerol through an ester bond.

eukarya includes all the eukaryotic cells, that is, the cells contain a nucleus and other membrane-bound cell organelles.

they can be autotrophic as well as heterotrophic, unicellular as well as multicellular

they include kingdoms like protista, plantae, animalia, fungi et cetera.

read more on -

explanation: