what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACCGTAACCACAACT and TACCTGTTAAGCTACTT?

What is the importantence of the carbon and nitretan cycles in the environment

How does the diagram explain ocean currents? earth tilt 23.5 degreesquestion 1 options: earth's tilt causes uneven heating of earth which causes currents.earth's tilt causes the ocean to move because of gravity.earth's tilt and its rotation cause currents.earth's tilt causes uneven distribution of salt which causes currents.

Agenetically engineered corn plant is approved for agricultural use. the plant produces pollen that can make its own toxins. these toxins protect the corn plant against pests and no longer require the application of chemical pesticide. what is a likely impact on the farmer of growing such a variety of corn? a- the financial costs for the farmer would be lowered since less crops would be lost to pests. b-the financial costs for the farmer would be lowered since more crops would be lost to pests. c-the farmer may be held responsible for increasing chemical pollution. d-the farmer's expenses for pest control would increase due to an increase in bee population.