Acertain segment of dna can be used as a molecular clock. its rate of mutation is one mutation per 20 million years. examine the dna segments from two different species:

species a: gtacctaagttcaccgaatt
species b: gaacctaagggcaccgaact

using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.

Based on the evidence in the excerpt above, describe in your own words what it would have been like for a person to enter a meat processing plant in the united states

Ateam from new york presbyterian hospital is conducting a study about a recent increase in cases involving both excess sweating and kidney stones. what would the team need before it draws a conclusion about the cases? medications that are specifically designed to treat the sickness machines that are built to process blood and reduce symptoms until patients are healthy again data that profile the various patients who report these symptoms proof that the excess sweating is related to the excessive kidney stones

1. emigration the movement of people from one place to another 2. immigration a situation in which resources are being used up at a faster rate than they can be replenished 3. migration the leaving of one's homeland to settle in a new place 4. overpopulation the movement of people to a new country 5. sustainable development a situation in which the birth rate is not sufficient to replace the existing population 6. underpopulation the ability to meet current needs without reducing the ability to meet future needs 7. unsustainable development the increase in the population of a city 8. urbanization a situation in which the number of people exceeds the available natural resources in an area