1) If a messenger RNA has the sequence:
5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is th...
1) If a messenger RNA has the sequence:
5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the corresponding sequence of the coding strand (DNA)?
b) What is the corresponding sequence of the template strand (DNA)?
c) What is each anticodon and what amino acid do the corresponding tRNA's carry?
d) What amino acid sequence would be translated from this mRNA fragment?
Answers: 3
Another question on Biology
Biology, 21.06.2019 23:00
Classify the structures as homologous or analogous, depending on their structure and function.
Answers: 1
Biology, 22.06.2019 02:00
If a baby girl guinea pig looks almost identical to its mother, does this then mean that it inherited more alleles from its mother? explain. (hint: think about the vocabulary words dominant and recessive.)
Answers: 1
Biology, 22.06.2019 05:00
(99 points) be serious! how do farts work? how do you fart without it stinking? serious answers only
Answers: 2
Biology, 22.06.2019 07:30
What is one way intensive agriculture can contribute to climate change? a. tree loss to agriculture increases earth's albedo b. livestock manure absorbs greenhouse gases c. large herds of livestock release greenhouse gases d. fewer trees are available to replenish petroleum stores appex
Answers: 2
You know the right answer?
Questions
History, 01.10.2019 11:20
Mathematics, 01.10.2019 11:20
Biology, 01.10.2019 11:30
History, 01.10.2019 11:30
Biology, 01.10.2019 11:30
Chemistry, 01.10.2019 11:30
History, 01.10.2019 11:30
Business, 01.10.2019 11:30
Mathematics, 01.10.2019 11:30
English, 01.10.2019 11:30
