subject
Biology, 15.10.2019 23:30 mpatel12

Which mutation in dna affects the whole dna sequence after the point mutation?

a.
inversion

b.
frameshift

c.
substitution

d.
translocation

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 19:10
Liquid water turns into water vapor at which step in the water cycle? a. precipitation o b. water run off c. evaporation d. condensation
Answers: 2
question
Biology, 22.06.2019 08:00
Can create a hboth of these instruments can measure wind speed. doppler radar and psychrometer anemometer and hygrometer doppler radar and anemometer radiosonde and psychrometer
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
Which of the following observation darwin shape his concept of descent with modification? a) species diversity declines farther from the equator. b) fewer species live on islands than on the nearest continents. c) birds live on islands located farther from the mainland than the bird's maximum nonstop flight distance. d) south american temperate plants are more similar to the tropical plants of south america than to the temperate plants of europe. e) earthquakes reshape life by causing mass extinctions.
Answers: 1
You know the right answer?
Which mutation in dna affects the whole dna sequence after the point mutation?

a.
...
Questions
question
Mathematics, 21.06.2019 20:30
question
Biology, 21.06.2019 20:30
Questions on the website: 13722367