subject
Biology, 28.09.2019 18:30 cabo531

Which describes the correct pairing of dna bases?

a. t with a, and c with g
b. t with c, and a with g
c. t with t, and c with c
d. t with g, and a with c

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 09:00
How can an organ, such as the lungs, work for multiple body systems?
Answers: 2
question
Biology, 22.06.2019 11:00
Which measure of an earthquake depends on how close you are to the focus?
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:30
Slow down transpiration by the stomata question 9 options: a guard cells; closing b chloroplasts; closing c guard cells; opening d chloroplasts; opening
Answers: 1
You know the right answer?
Which describes the correct pairing of dna bases?

a. t with a, and c with g
b. t...
Questions
question
Chemistry, 16.11.2019 12:31
question
Mathematics, 16.11.2019 12:31
question
Mathematics, 16.11.2019 12:31
Questions on the website: 13722360