Answers: 1
Biology, 22.06.2019 09:00
Anurse is caring for a 42-year-old client who is scheduled for an amniocentesis during the fifteenth week of gestation because of concerns regarding down syndrome. what other fetal problem does an examination of the amniotic fluid reveal at this time?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:40
1. -define adaptation2 explain darwin's theories of descent with modification and natural selection in detail3. -explain how each of these provides evidence for evolution: a. -fossil record, including superposition and transitional fossilsb-anatomy, including homologous structuresc-biological molecules, including dna and proteins4. -explain the difference between convergent and divergent evolution.5. -define and give three examples of artificial selection6. -define and give one example of coevolution.7. -explain biodiversity and how it benefits humans.8. -explain a type of population lest affected by environmental change.
Answers: 3
Biology, 22.06.2019 22:30
Text version using the diagram above, match the description to the corresponding location in the carbon cycle model. provide the letter only. carbon dioxide is converted to sugar used for food. carbon trapped in fossil fuels is converted to carbon dioxide. organic carbon is converted to fossil fuels. carbon dioxide is converted to carbonates. sugar is broken down and converted to carbon dioxide. location location location location location
Answers: 1
The length of a vertebrate's determine its ability to concentrate urine. a. axons b. synapses c. ma...
Mathematics, 25.06.2019 00:00
Mathematics, 25.06.2019 00:00
Mathematics, 25.06.2019 00:00
Mathematics, 25.06.2019 00:00