subject
Biology, 16.09.2019 17:30 nett4386

Why is there not much life on the deep ocean bottom?

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 21:30
The diagram is represented of a part of a plant cell. identify the locations where proton concentration builds up during photosynthesis and cellular respiration
Answers: 2
question
Biology, 22.06.2019 22:00
10 points a population of mice have tails. over time those mice with either really short tails or really long tails have a higher rate of survival. this will probably lead to what type of selection? a. disruptiveb. directionalc. stabilizingd. evological
Answers: 1
question
Biology, 23.06.2019 00:30
What monomers build nucleic acid? how many are there?
Answers: 2
You know the right answer?
Why is there not much life on the deep ocean bottom?...
Questions
question
Mathematics, 19.09.2019 04:30
question
English, 19.09.2019 04:30
Questions on the website: 13722359