Asap
which of these is an example of gene flow?
a) german immigrants settle in a colony in eastern pennsylvania without mixing with the locals.
b) a few black sparrows join a population of brown sparrows and mate with them.
c) indiscriminate hunting reduces the blue whale population, which later revives.

Explain the side effects of cancer treatments

Drag each label to the correct location in the equation. not all tiles will be used. the density of mercury is 13.6 grams per cubic centimeter. complete the steps for converting 13.6 g/cm3 to kg/m3. (1 kg = 1,000 g, 1 m3 = 106 cm3)

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?