![subject](/tpl/images/cats/biologiya.png)
Biology, 07.11.2019 13:31 kileykittykt8184
Identical duplicates of the mother cell are created by mitosis meiosis cytokinesis
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 15:50
Providing immunity by injecting the body with a weakened form a pathogen is known as
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:30
African penguins, which inhabit the coasts of southern africa, were classified as an endangered species in 2010. two significant threats to their survival are ecosystem damage from oil spills and overfishing by humans. overfishing depletes the food supply of african penguins. the best method to reduce the threat of overfishing would be to . the risk of oil spills could be reduced by increasing the use of , which should oil consumption. if an oil spill does occur, could be used to remove the oil so the ecosystem may more quickly recover.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:30
This class has taught you that the use of science and medicine in practical ways has become an international endeavor. one of the greatest examples of an international science accomplishment is which allows the profiling of human dna, useful not only to science but also medicine. a) forensic science b) the fbi c) the human genome project d) bioterrorism
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Identical duplicates of the mother cell are created by mitosis meiosis cytokinesis...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/fizika.png)
Physics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/es.png)
Spanish, 16.09.2020 23:01
![question](/tpl/images/cats/biologiya.png)
Biology, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mir.png)
World Languages, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01
![question](/tpl/images/cats/en.png)
English, 16.09.2020 23:01
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 16.09.2020 23:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 23:01