Answers: 3
Biology, 21.06.2019 21:20
Atypical human cell is approximately 12.00 μm in diameter and enclosed by a membrane that is 5.000 nm thick. (a) what is the volume of the cell including the membrane? (b) what is the volume of the cell membrane? (c) what percent of the total volume does its membrane occupy? to simplify the calculations, model the cell as a sphere. enter your answers using four significant figures.
Answers: 3
Biology, 22.06.2019 04:30
Asap brainliest will be which sentence about protists is accurate? all protists are unicellular and microscopic in nature. they have organelles, so protists are eukaryotic in nature. all protists make their own energy through photosynthesis.
Answers: 1
Biology, 22.06.2019 06:40
Which scientific design has both practical limitations and limitations due to scale? studying the effect of bleach on the growth of mold spores exposing cultures of duckweed to different intensities of light observing the replication of dna molecules with a hand lens using colored marbles to model a cross between two colors of rabbits
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Why do we need to cut our hair and finger nails?...
Mathematics, 28.04.2021 01:00
Geography, 28.04.2021 01:00
Mathematics, 28.04.2021 01:00
Mathematics, 28.04.2021 01:00
Mathematics, 28.04.2021 01:00
Mathematics, 28.04.2021 01:00
Mathematics, 28.04.2021 01:00