Suspect a
tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga

suspect b
tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga

suspect c
ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga

probe
aggt

questions

answer these following questions in the essay box below.

which suspect most likely committed the robbery?
how do you know?

The most likely suspect would be suspect C because their DNA have most in common with the sample.

Explanation:

pls give brainiest

they had the law tat factories that produces smoke cannot be built near residential buildings.

building of proper sewage system was done to ensure that the waste is carried away from the humans so that they do not get diseases from it.

also they built water systems to provide water in those areas which are drought prone.