Human females produce egg cells that have
a. one x chromosome.
b. two x chromosomes. <...
![subject](/tpl/images/cats/biologiya.png)
Biology, 12.10.2019 06:30 shelbymelton18
Human females produce egg cells that have
a. one x chromosome.
b. two x chromosomes.
c. one x or one y chromosome.
d. one x and one y chromosome
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 18:00
Food provides molecules that serve as fuel and building material for all organisms. plants undergo photosynthesis and make their own food. other organisms, like us and the horse seen above, are consumers and eat food. how do all organisms use food as fuel? be sure to include the name of the process in your answer. me.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:50
One function of the poly-a tail on eukaryotic mrna sequences is to the mrna be transported from the nucleus to the cytoplasm. prokaryotic mrna also has a poly-a tail. choose the best explanation of the prokaryotic poly-a tail. a. prokaryotic poly-a tails are composed of a different molecular structure compared with eukaryotic poly-a tails. b. prokaryotic poly-a tails have the same functions as eukaryotic poly-a tails, because this process is highly conserved throughout different species. c. prokaryotic poly-a tails aren't important, because prokaryotes don't have nuclei. d. prokaryotic poly-a tails have other functions,because prokaryotes don't have nuclei.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
Questions
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
History, 04.07.2019 14:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.07.2019 14:20
![question](/tpl/images/cats/es.png)
Spanish, 04.07.2019 14:20
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 04.07.2019 14:20
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.07.2019 14:20
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.07.2019 14:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 04.07.2019 14:20
![question](/tpl/images/cats/himiya.png)
Chemistry, 04.07.2019 14:20
![question](/tpl/images/cats/istoriya.png)
History, 04.07.2019 14:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 04.07.2019 14:20