According to mendel's law of segregation, different alleles are separated into different gametes, or sex cells. according to the mendel's law of independent assortment

Sally and sue were investigating the topic of friction in science. they used a small car and a ramp as seen in the picture to test what they were learning. they knew that they slipped easily on waxed floors but not on carpet, so they decided to change the material on the surface of the ramp to see what happened. they planned to use glass, carpet, aluminum foil, and sandpaper and run the car down the ramp over each surface. what would be the best research question to guide the girls' experiment? a) does the amount of surface area affect the friction on the moving car? b) will the car travel fastest on the glass surface? c) how does the angle of the ramp affect the speed of the car? d)do rougher surfaces tend to create more friction than smooth surfaces?

The illustration shown is an ovum, a female sex cell. a mutation in this cell may be passed to the woman’s offspring during a) birth. b) mitosis. c) dna replication. d) sexual reproduction

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?