The majority of photosynthesis occurring in plants takes place in the upper palisade layer of leaves. therefore, it can be concluded that cells in the upper palisade layer contain more than other parts of the plant.

The many volcanoes located along the edge of the pacific ocean make up the ring of fire. how does subduction play a role in the volcanic activity in the ring of fire?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

First idea: suddenly, women were leaving their homes to cycle and socialize on country roads and city streets. —wheels of change, sue macy second idea: it was not a stretch for some cyclists to see the possibility of a larger role for women in the world. —wheels of change, sue macy what type of graphic organizer would best represent the connection between these two ideas? 1) a t-chart that separates ideas into two different categories 2) a chronology that shows 3) a sequence of several events a cause-and-effect graphic that shows how one idea led to another 4)a problem-solution graphic that presents a problem and a solution to the problem