Answers: 1
Biology, 22.06.2019 03:20
Mrna decodes information from the original dna master plan to build proteins in the during the process of ribosomes.
Answers: 3
Biology, 22.06.2019 10:00
In the presence of oxygen, glycolysis is followed a. the krebs cycle b. lactic acid fermentation c. alcoholic fermentation d. photosynthesis
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:30
Aquantity of gas has a volume of 18 m3 and an absolute temperature of 225 k. when the temperature of the gas is raised to 380 k, what is the new volume of the gas? (assume that there’s no change in pressure.)
Answers: 1
The body shapes of porpoises and sharks are similar in appearance. yet recent ancestors to the porpo...
History, 12.10.2020 23:01
Mathematics, 12.10.2020 23:01
Mathematics, 12.10.2020 23:01
Mathematics, 12.10.2020 23:01
Mathematics, 12.10.2020 23:01
Mathematics, 12.10.2020 23:01
Advanced Placement (AP), 12.10.2020 23:01
Social Studies, 12.10.2020 23:01