![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:00
14. which of the following codons code for threonine? a. ucg b. ugu c. cga d. aca
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:10
Recombinant dna is the merging of dna from unrelated organisms to create new genetic varieties is assembled in the lab from mononucleotides was part of the green revolution of the 1960s is pollination of one plant by another of the same species is cross-pollination of one plant by a different species
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:40
1. -define adaptation2 explain darwin's theories of descent with modification and natural selection in detail3. -explain how each of these provides evidence for evolution: a. -fossil record, including superposition and transitional fossilsb-anatomy, including homologous structuresc-biological molecules, including dna and proteins4. -explain the difference between convergent and divergent evolution.5. -define and give three examples of artificial selection6. -define and give one example of coevolution.7. -explain biodiversity and how it benefits humans.8. -explain a type of population lest affected by environmental change.
Answers: 3
You know the right answer?
The first organism in a succession is called the...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 07.03.2021 06:40
![question](/tpl/images/cats/es.png)
Spanish, 07.03.2021 06:40
![question](/tpl/images/cats/mat.png)
Mathematics, 07.03.2021 06:40
![question](/tpl/images/cats/en.png)
English, 07.03.2021 06:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.03.2021 06:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.03.2021 06:40
![question](/tpl/images/cats/mat.png)
Mathematics, 07.03.2021 06:40
![question](/tpl/images/cats/mat.png)
Mathematics, 07.03.2021 06:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 07.03.2021 06:40
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 07.03.2021 06:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
Physics, 07.03.2021 06:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)