Biology, 20.09.2019 23:00 atnlakshmanan
Two animals that can be found at the grand canyon include the abert’s and kaibab squirrels. the abert’s squirrel is found at the south rim of the canyon and in a few surrounding states. the kaibab squirrel, however, can only be found at the canyon’s north rim, mainly on the kaibab plateau. the kaibab squirrel is not found anywhere else in the world. scientists believe that the squirrels are actually closely related and have developed separately as a result of geographic isolation. it is possible that the squirrels were separated by plateau erosion that separated the forests and isolated the kaibab population. some scientists are studying if the squirrels are now two separate species or if the kaibab squirrel is simply a subspecies of the abert’s squirrel. separate species are unable to reproduce with each other. which evidence would be used to support the claim that the squirrels are two separate species?
the abert’s squirrel is found at the south rim of the canyon, but the kaibab squirrel is found at the north rim of the canyon.
geologists prove that plateau erosion is the main cause of forest separation in the region.
scientists observe that abert’s squirrels are slightly larger and have bushier tails than kaibab squirrels do.
when placed together in pairs for study, no pair of abert’s squirrel and kaibab squirrel result in offspring.
Answers: 1
Biology, 22.06.2019 10:40
Which of the following is a period in the paleozoic era? devonian cambrian permian all of the above
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:20
Pl as time goes by and water goes through the water cycle again and again, the amount of water on earth: increases decreases ostays the same goes up and down
Answers: 1
Biology, 22.06.2019 15:50
We all have different forms of genes from our parent(s).what are these different forms called? a.alleles b.characters c.dna d.resources
Answers: 2
Two animals that can be found at the grand canyon include the abert’s and kaibab squirrels. the aber...
Mathematics, 08.04.2021 21:40
Mathematics, 08.04.2021 21:40
Mathematics, 08.04.2021 21:40
Mathematics, 08.04.2021 21:40
History, 08.04.2021 21:40
Computers and Technology, 08.04.2021 21:40
Mathematics, 08.04.2021 21:40
Mathematics, 08.04.2021 21:40