subject
Biology, 28.01.2020 02:31 hsjsjsjdjjd

When plants wilt they're soft stems and leaves begin to drop what is going on inside the plant cells that causes the plant to drop like this

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 16:30
Which animal group is the largest and contains more species from all the other living groups combined? is it mammals or
Answers: 1
question
Biology, 22.06.2019 07:00
Pls ! in your opinion, what are the limiting factors that might affect the growth or diversity of our ecosystem? respond to this question in claim, evidence, reasoning format. 1. make your claim (i are the limiting factors that might affect the growth or diversity of our 2. follow the claim with 3 pieces of evidence. evidence may be taken from the reading, the videos, previous lessons, or googled answers. site sources, too. 3. use reasoning to explain why you chose your evidence.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 18:20
During the final stage of the cell cycle, cytokinesis allows the cell to finish dividing, creating with copies of dna. can someone fill in the blanks?
Answers: 1
You know the right answer?
When plants wilt they're soft stems and leaves begin to drop what is going on inside the plant cells...
Questions
question
Arts, 04.12.2020 01:20
question
Business, 04.12.2020 01:20
question
History, 04.12.2020 01:20
question
Mathematics, 04.12.2020 01:20
question
Mathematics, 04.12.2020 01:20
question
English, 04.12.2020 01:20
Questions on the website: 13722360