Answers: 1
Biology, 21.06.2019 20:00
Read the following scenario to answer the following question. over the past 60 years, many amphibian species have experienced significant population declines, and some species have become extinct. scientists suspected that local human activities such as the destruction of wetlands, regional pollution, and deforestation were the main reasons for these losses. however, research over the past 20 years reveals significant amphibian population declines in protected areas of the world, such as nature preserves and parks. these global declines suggest widespread problems including increased ultraviolet radiation, acid rain, and disease. in switzerland, for example, 14 of the 20 native amphibian species are threatened with extinction. when most populations of a wide-ranging amphibian species are lost and the few remaining populations are widely separated, we expect to see that a. the founder effect becomes increasingly important b. microevolution no longer occurs c. gene flow between populations is reduced d. artificial selection becomes a greater factor in microevolution
Answers: 2
Biology, 22.06.2019 10:00
Dna and rna share a number of similarities,but they also differ in certain aspects of their structure. wich nitrogenous base is found in rna but is not found in dna
Answers: 1
Biology, 22.06.2019 11:30
What is the membrane that sheath of schwann cell containing cytoplasm and nucleus that encloses myelin
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Cells are engaged in an ongoing depending on the cell type, water normally accounts for...
Biology, 20.05.2020 04:59
English, 20.05.2020 04:59
History, 20.05.2020 04:59
Health, 20.05.2020 04:59
Mathematics, 20.05.2020 04:59
Law, 20.05.2020 04:59
Mathematics, 20.05.2020 04:59
Mathematics, 20.05.2020 04:59
Mathematics, 20.05.2020 04:59
Mathematics, 20.05.2020 04:59
Mathematics, 20.05.2020 04:59
Advanced Placement (AP), 20.05.2020 04:59
Health, 20.05.2020 04:59