subject
Biology, 18.09.2019 23:30 ericwheeler821

Which of the following is a characteristic of blood type ab+?
has antibodies a and b in the blood plasma
has antigens a and b on the red blood cells
has no rh antigen on the red blood cell
has antibodies o in the blood plasma

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 09:30
Which statement names a physical property of wood? wood does not rustwood can burnwood can rotwood is softer than coal
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:10
Pls the table below shows the role of different substances during photosynthesis. substance role during photosynthesis glucose stores chemical energy water combines with glucose to form carbon dioxide chlorophyll traps sunlight which of the following statements would correct one of the roles listed in the table? glucose combines with carbon to form water. chlorophyll reacts with light to produce carbon dioxide. water combines with carbon dioxide during photosynthesis. chlorophyll stores chemical energy needed for photosynthesis.
Answers: 2
question
Biology, 22.06.2019 21:30
Part a - which gene to compare? in this exercise, you will use the cytochrome c oxidase i (coi) gene to investigate relationships among salmon species. (this gene encodes a protein that functions in the mitochondrial electron transport chain.) you will compare the coi gene sequences from your salmon test samples to the standard sequences for each salmon species. in order for the coi gene to be useful for distinguishing among the different salmon species, which three statements must be true?
Answers: 2
You know the right answer?
Which of the following is a characteristic of blood type ab+?
has antibodies a and b in the b...
Questions
question
Social Studies, 21.04.2020 21:58
Questions on the website: 13722361